View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5773-Insertion-9 (Length: 145)

Name: NF5773-Insertion-9
Description: NF5773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5773-Insertion-9
NF5773-Insertion-9
[»] chr3 (2 HSPs)
chr3 (8-145)||(20899880-20900016)
chr3 (8-145)||(13949645-13949782)
[»] scaffold0771 (1 HSPs)
scaffold0771 (8-145)||(1785-1922)
[»] chr5 (2 HSPs)
chr5 (41-105)||(40700883-40700947)
chr5 (41-98)||(40719150-40719207)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 1e-60; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 1e-60
Query Start/End: Original strand, 8 - 145
Target Start/End: Original strand, 20899880 - 20900016
Alignment:
8 atagttactatttcatgacaattttctttacctttttgtggtcagttttggtgccgggtgctcccaactcctgtctgatatgcaggctttcaaggtcata 107  Q
    |||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
20899880 atagttactatttcttgacaattttctttacctttttgtggttagttttggtgccgggtgctcccaactcctgtctgatatgcaggctttcaaggtcata 20899979  T
108 ctctccctcgacgagaactttttaccaatattcttaat 145  Q
    ||||||||||||||||| | ||||||||||||||||||    
20899980 ctctccctcgacgagaa-tatttaccaatattcttaat 20900016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 8 - 145
Target Start/End: Original strand, 13949645 - 13949782
Alignment:
8 atagttactatttcatgacaattttctttacctttttgtggtcagttttggtgccgggtgctcccaactcctgtctgatatgcaggctttcaaggtcata 107  Q
    |||||| ||||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||    
13949645 atagttgctatttcttgacaattttctttacctttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtcata 13949744  T
108 ctctccctcgacgagaactttttaccaatattcttaat 145  Q
    |||| ||||||||||||   |||||| |||||||||||    
13949745 ctcttcctcgacgagaatactttaccgatattcttaat 13949782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0771 (Bit Score: 98; Significance: 1e-48; HSPs: 1)
Name: scaffold0771
Description:

Target: scaffold0771; HSP #1
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 8 - 145
Target Start/End: Original strand, 1785 - 1922
Alignment:
8 atagttactatttcatgacaattttctttacctttttgtggtcagttttggtgccgggtgctcccaactcctgtctgatatgcaggctttcaaggtcata 107  Q
    |||||| ||||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||    
1785 atagttgctatttcttgacaattttctttacctttttatggtcagtgttggtgccgggtgctcccaactcctgtctgatatgcaggccttcaaggtcata 1884  T
108 ctctccctcgacgagaactttttaccaatattcttaat 145  Q
    |||| ||||||||||||   |||||| |||||||||||    
1885 ctcttcctcgacgagaatactttaccgatattcttaat 1922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.000000000003; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 41 - 105
Target Start/End: Original strand, 40700883 - 40700947
Alignment:
41 ttttgtggtcagttttggtgccgggtgctcccaactcctgtctgatatgcaggctttcaaggtca 105  Q
    ||||||||||||| ||||||| || ||||| ||||| || || ||||||||||||||||||||||    
40700883 ttttgtggtcagtgttggtgctggctgctcgcaactgctctcagatatgcaggctttcaaggtca 40700947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 41 - 98
Target Start/End: Original strand, 40719150 - 40719207
Alignment:
41 ttttgtggtcagttttggtgccgggtgctcccaactcctgtctgatatgcaggctttc 98  Q
    ||||||||||||| |||||||| | ||||| ||||| || || |||||||||||||||    
40719150 ttttgtggtcagtgttggtgcccgctgctcgcaactgctctcagatatgcaggctttc 40719207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University