View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5774-Insertion-13 (Length: 272)
Name: NF5774-Insertion-13
Description: NF5774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5774-Insertion-13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 9 - 272
Target Start/End: Complemental strand, 36223453 - 36223190
Alignment:
| Q |
9 |
tatctaacatagggaacatggtgctatttgtagcaaaagtttatgcttcaattcaaagtagatctttggctgtgattgcatcaactttggactcactctt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223453 |
tatctaacatagggaacatggtgctatttgtagcaaaagtttatgcttcaattcaaagtagatctttggctgtgattgcatcaactttggactcactctt |
36223354 |
T |
|
| Q |
109 |
ggatctcttgtctggatttatactttggttcacttctcatactatgagtaaaccaaactatgatcaataccctattggcaagaaccgtatgcaacctgtg |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223353 |
ggatctcttgtctggatttatactttggttcacttctcatactatgagtaaaccaaactatgatcaataccctattggcaagaaccgtatgcaacctgtg |
36223254 |
T |
|
| Q |
209 |
gtaaaagcttccttctcttagaacacacctaagccaattttcataatattaatttttatgttac |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36223253 |
gtaaaagcttccttctcttagaacacacctaagccaattttcataatattaatttttatgttac |
36223190 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 27 - 142
Target Start/End: Complemental strand, 18645061 - 18644946
Alignment:
| Q |
27 |
tggtgctatttgtagcaaaagtttatgcttcaattcaaagtagatctttggctgtgattgcatcaactttggactcactcttggatctcttgtctggatt |
126 |
Q |
| |
|
|||||||||||| ||| || || ||||| |||||| | || ||||| || ||||||||||| || || ||||| || ||||||||||| ||||| || || |
|
|
| T |
18645061 |
tggtgctatttgcagcgaaggtatatgcatcaattgagagcagatcattagctgtgattgcttccaccttggattctctcttggatcttttgtcggggtt |
18644962 |
T |
|
| Q |
127 |
tatactttggttcact |
142 |
Q |
| |
|
||| | ||||||||| |
|
|
| T |
18644961 |
catattgtggttcact |
18644946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University