View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5774_high_13 (Length: 260)
Name: NF5774_high_13
Description: NF5774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5774_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 156 - 248
Target Start/End: Complemental strand, 5155032 - 5154940
Alignment:
| Q |
156 |
gttcctgaaaccaaaatacaattaaacatgtgctttatgtgaaatttgaggattcaagtttgtgatttggagtggaactagattgtccgtctg |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5155032 |
gttcctgaaaccaaaatacaattaaacatgtgctttatgtgaaatttgaggattcaagtttgtgatttggagtggaactagattgtccgtctg |
5154940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 5155161 - 5155129
Alignment:
| Q |
25 |
gctgttaccggactattcaatatcctgattcgg |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5155161 |
gctgttaccggactattcaatatcctgattcgg |
5155129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University