View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5774_high_15 (Length: 245)
Name: NF5774_high_15
Description: NF5774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5774_high_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 9 - 245
Target Start/End: Complemental strand, 30942076 - 30941837
Alignment:
| Q |
9 |
tatgtggcctttttatcaagtaagatttcaaaaattattggaggtttaaggcaattgcctttgttgccttgcccttggaccgaccttgttgctttgtagc |
108 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
30942076 |
tatgtggcatttttatcaagtaagatttcaaaaaatattggaggtttaaggcgattgcctttgttgccttacccttggaccgaccttgctgctttgtagc |
30941977 |
T |
 |
| Q |
109 |
tgcagacgt---catacttggtcgaattacgtaaacaaacgatcgtgttcattgtcttgcaattaatcgtttcaaattttcttctattagtagtgtttgt |
205 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30941976 |
tgcagacgtaggcatacttggtcaaattacgtaaacaaacgatcgtgttcattgtcttgcaattaatcgtttcaaattttcttctattagtagtgtttgt |
30941877 |
T |
 |
| Q |
206 |
tctaacaagatgaagtattaattttgtttcttcaaccaac |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30941876 |
tctaacaagatgaagtattaattttgtttcttcaaccaac |
30941837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University