View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5774_low_14 (Length: 260)

Name: NF5774_low_14
Description: NF5774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5774_low_14
NF5774_low_14
[»] chr2 (2 HSPs)
chr2 (156-248)||(5154940-5155032)
chr2 (25-57)||(5155129-5155161)


Alignment Details
Target: chr2 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 156 - 248
Target Start/End: Complemental strand, 5155032 - 5154940
Alignment:
156 gttcctgaaaccaaaatacaattaaacatgtgctttatgtgaaatttgaggattcaagtttgtgatttggagtggaactagattgtccgtctg 248  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5155032 gttcctgaaaccaaaatacaattaaacatgtgctttatgtgaaatttgaggattcaagtttgtgatttggagtggaactagattgtccgtctg 5154940  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 25 - 57
Target Start/End: Complemental strand, 5155161 - 5155129
Alignment:
25 gctgttaccggactattcaatatcctgattcgg 57  Q
    |||||||||||||||||||||||||||||||||    
5155161 gctgttaccggactattcaatatcctgattcgg 5155129  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University