View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5774_low_17 (Length: 239)
Name: NF5774_low_17
Description: NF5774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5774_low_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 17 - 223
Target Start/End: Complemental strand, 24834328 - 24834122
Alignment:
| Q |
17 |
agtgccaacatggactcctctactaccaagatcttggcagttgcaaccactattatgaatgacatttctgcaccagctttgttgacgtatcaacgcctct |
116 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24834328 |
agtgccaacatggactcctctaccaccaagatcttggcagtcgcaaccactattatgaatgacatttctgcaccagctttgttgacgtatcaacgcctct |
24834229 |
T |
 |
| Q |
117 |
tttctccatcagcttgcttttattctgcatctactcatcccttccaaactgtgctccattaaccttgagctttctcccatcaaaccacacatcccccatc |
216 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||| |||||| ||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
24834228 |
tttctccatcagcttgcttttattttgcatctactcatcccttccaaaccgtgctctattaaccttgaactttatcccatcaaaccacacatcccccatc |
24834129 |
T |
 |
| Q |
217 |
ctacttc |
223 |
Q |
| |
|
||||||| |
|
|
| T |
24834128 |
ctacttc |
24834122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University