View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5775-Insertion-16 (Length: 234)
Name: NF5775-Insertion-16
Description: NF5775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5775-Insertion-16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 8 - 234
Target Start/End: Complemental strand, 44379716 - 44379490
Alignment:
| Q |
8 |
ttgctctcttaattgctgtgaagaatttgtagcttgaatcatagcctttaaaatatgtgattatttctctgaatttgttttctatctgagctgcaacagg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44379716 |
ttgctctcttaattgctgtgaagaatttgtagcttgaatcatagcctttaaaatatgtgattatttctctgaatttgttttctatctgagctgcaacagg |
44379617 |
T |
|
| Q |
108 |
tgtactagtttannnnnnncacccttttgttgatgtattcttggaattttccatctaagttcttccatttgattttacaaataatcaggaaaaactgttt |
207 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44379616 |
tgtactagtttatttttttcacccttttgttgatgtattcttggaattttccatctaagttcttccatttgattttacaaataatcaggaaaaactgttt |
44379517 |
T |
|
| Q |
208 |
cacttgtcaagtatttttgtaattggg |
234 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
44379516 |
cacttgtcaagtatttttgtaattggg |
44379490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University