View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5775-Insertion-17 (Length: 220)
Name: NF5775-Insertion-17
Description: NF5775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5775-Insertion-17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 217
Target Start/End: Complemental strand, 5546233 - 5546027
Alignment:
| Q |
11 |
tagtgtgattgttcgagaattcgaagttaataaagacaaagaaagagtagaagcagttgaaaggacatgtgaagttggacctagtaaccaactttctctc |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5546233 |
tagtgtgattgttcgagaattcgaagttaataaagacaaagaaagagtagaagcagttgaaaggacatgtgaagttggacctagtaaccaactttctctc |
5546134 |
T |
|
| Q |
111 |
ttcaccgacatgcttggtgaccccatttgcagggtccgccactcaccttcttacctcatgctggtatatattcacaaaagtcattcattttcactattct |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5546133 |
ttcaccgacatgcttggtgaccccatttgcagggtccgccactcaccttcttacctcatgctggtatatattcacaaaaatcattcattttcactattct |
5546034 |
T |
|
| Q |
211 |
attactt |
217 |
Q |
| |
|
||||||| |
|
|
| T |
5546033 |
attactt |
5546027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 38 - 176
Target Start/End: Original strand, 39917998 - 39918136
Alignment:
| Q |
38 |
taataaagacaaagaaagagtagaagcagttgaaaggacatgtgaagttggacctagtaaccaactttctctcttcaccgacatgcttggtgaccccatt |
137 |
Q |
| |
|
||||||||| | |||||| || ||||||||||||| | ||||||||||||||| ||| | ||||| |||||||||||| ||| |||||||| ||| |
|
|
| T |
39917998 |
taataaagatagagaaagtgttgaagcagttgaaaaaatatgtgaagttggacccagtggtaagctttccctcttcaccgacttgcacggtgaccctatt |
39918097 |
T |
|
| Q |
138 |
tgcagggtccgccactcaccttcttacctcatgctggta |
176 |
Q |
| |
|
||||| ||||| ||||||| ||| |||||||||||| |
|
|
| T |
39918098 |
tgcagagtccgtaactcaccaacttttctcatgctggta |
39918136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University