View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5775-Insertion-19 (Length: 173)
Name: NF5775-Insertion-19
Description: NF5775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5775-Insertion-19 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 8 - 173
Target Start/End: Complemental strand, 12502560 - 12502395
Alignment:
| Q |
8 |
acatgtgcagacaaatatattattcagagatatttcagctgccaatgggccagatgatatggaggttgcagccgttggtgcagtttgtgggttgttatat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12502560 |
acatgtgcagacaaatatattattcagagatatttcagctgccaatgggccagatgatatggaggttgcagccgttggtgcagtttgtgggttgttatat |
12502461 |
T |
 |
| Q |
108 |
gttatcttgaacacattgccacttgaaagtattatgactgtgctcgcctacagaactgaccttgtt |
173 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
12502460 |
gttatcttgaacacattgccacttgaaagtattatgactgtgcttgcctacagaactgaccttgtt |
12502395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 134; E-Value: 5e-70
Query Start/End: Original strand, 8 - 173
Target Start/End: Complemental strand, 12479526 - 12479361
Alignment:
| Q |
8 |
acatgtgcagacaaatatattattcagagatatttcagctgccaatgggccagatgatatggaggttgcagccgttggtgcagtttgtgggttgttatat |
107 |
Q |
| |
|
|||| ||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
12479526 |
acatttgcagacaaatatattatttagagatatttcatctgccaatgggccagatgatatggaggttgcagccgttggtgcagtttgcgggtttttatat |
12479427 |
T |
 |
| Q |
108 |
gttatcttgaacacattgccacttgaaagtattatgactgtgctcgcctacagaactgaccttgtt |
173 |
Q |
| |
|
||| ||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12479426 |
gttgtcttgaacacattgccaattgaaaggattatgactgtgctcgcctacagaactgaccttgtt |
12479361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University