View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5775_low_12 (Length: 227)
Name: NF5775_low_12
Description: NF5775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5775_low_12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 110 - 227
Target Start/End: Original strand, 31433695 - 31433812
Alignment:
| Q |
110 |
cactctaaatcaggacttgtttcaaaatatgtttgatggttggaggctgtatgttatgcagcaggttaattaggatctgtggattcgtgtagcttggaga |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||||||||||||| |
|
|
| T |
31433695 |
cactctaaatcaagacttgtttcaaaatatgtttgatggttggaggctgtatgttatgcagcaggttaattaggaccggcggattcgtgtagcttggaga |
31433794 |
T |
|
| Q |
210 |
aaagatttgaaccatttt |
227 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
31433795 |
aaagatttgaaccatttt |
31433812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University