View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5775_low_12 (Length: 227)

Name: NF5775_low_12
Description: NF5775
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5775_low_12
NF5775_low_12
[»] chr1 (1 HSPs)
chr1 (110-227)||(31433695-31433812)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 110 - 227
Target Start/End: Original strand, 31433695 - 31433812
Alignment:
110 cactctaaatcaggacttgtttcaaaatatgtttgatggttggaggctgtatgttatgcagcaggttaattaggatctgtggattcgtgtagcttggaga 209  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||||||||||    
31433695 cactctaaatcaagacttgtttcaaaatatgtttgatggttggaggctgtatgttatgcagcaggttaattaggaccggcggattcgtgtagcttggaga 31433794  T
210 aaagatttgaaccatttt 227  Q
    ||||||||||||||||||    
31433795 aaagatttgaaccatttt 31433812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University