View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5776_low_3 (Length: 248)
Name: NF5776_low_3
Description: NF5776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5776_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 39666666 - 39666829
Alignment:
| Q |
1 |
aaggtcttagaaaactgagaagctgaagcaaaaccagtagtagcatttggtttattcaaaccatgatcatcataaccatttagttttgtttcctcatcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39666666 |
aaggtcttagaaaactgagaagctgaagcaaaaccagtagtagcatttggtttattcaaaccatgatcatcataaccatttagttttgtttcctcgtcat |
39666765 |
T |
 |
| Q |
101 |
tatcaataaccaattgagattcgtctcttgaattaataacaccagtggaacctttaacaccaac |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39666766 |
tatcaataaccaattgagattcgtctcttgacttaataacaccagtggaacctttaacaccaac |
39666829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 93; Significance: 2e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 57 - 161
Target Start/End: Original strand, 42257348 - 42257452
Alignment:
| Q |
57 |
caaaccatgatcatcataaccatttagttttgtttcctcatcattatcaataaccaattgagattcgtctcttgaattaataacaccagtggaaccttta |
156 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
42257348 |
caaaccatgatcatcgtaaccatttagttttgtttcctcatcattatcaataaccaattgagattcttctcttgacttaataacaccagtggaaccttta |
42257447 |
T |
 |
| Q |
157 |
acacc |
161 |
Q |
| |
|
||||| |
|
|
| T |
42257448 |
acacc |
42257452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University