View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5777-Insertion-5 (Length: 245)
Name: NF5777-Insertion-5
Description: NF5777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5777-Insertion-5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 10 - 244
Target Start/End: Original strand, 10751822 - 10752056
Alignment:
| Q |
10 |
gcgagcatgtgcgaagctgatgtaagatggccttcttatgcatacaatatacaaggtgaatcaaatggtgcaatgagatggattacaaatatgtctgaat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10751822 |
gcgagcatgtgcgaagctgatgtaagatggccttcttatgcatacaatatacaaggtgaatcaaatggtgcaatgagatggattacaaatatgtctgaat |
10751921 |
T |
 |
| Q |
110 |
caagtcttcaaacaataagctatggcaccaatcatatctatgattgcaagggtcatatttaattttctgcttctgacataaaattttgagtagtttagtt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10751922 |
caagtcttcaaacaataagctatggcaccaatcatatctatgattgcaagggtcatatttaattttctgcttctgacataaaattttgagtagtttagtt |
10752021 |
T |
 |
| Q |
210 |
taacagcctgattattttgtctacacatttttcac |
244 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| |
|
|
| T |
10752022 |
taacggcctgattattttgtctacacatttttcac |
10752056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 27 - 137
Target Start/End: Original strand, 32561286 - 32561396
Alignment:
| Q |
27 |
tgatgtaagatggccttcttatgcatacaatatacaaggtgaatcaaatggtgcaatgagatggattacaaatatgtctgaatcaagtcttcaaacaata |
126 |
Q |
| |
|
|||||||||||||||||||| |||||| |||||| |||| |||| |||||| | ||||||||| |||||||||||||||| ||||| ||||| | || |
|
|
| T |
32561286 |
tgatgtaagatggccttcttttgcatataatataaaaggagaattgaatggtcctatgagatgggttacaaatatgtctgattcaagccttcatgctatc |
32561385 |
T |
 |
| Q |
127 |
agctatggcac |
137 |
Q |
| |
|
||||||||||| |
|
|
| T |
32561386 |
agctatggcac |
32561396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University