View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5777_high_8 (Length: 348)

Name: NF5777_high_8
Description: NF5777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5777_high_8
NF5777_high_8
[»] chr4 (2 HSPs)
chr4 (1-99)||(10126626-10126724)
chr4 (50-110)||(10126724-10126784)


Alignment Details
Target: chr4 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 10126626 - 10126724
Alignment:
1 tttcatgctctcataacttccaagaagaaagtgaatcgaatttactccctttagaaggatcatggagtgagggtgactgacaacccgggtatgagtaat 99  Q
    ||||||||||  || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||    
10126626 tttcatgctccgatgacttccaagaagaaagtgaatcgaatttactccctttagaaggatcatggagtgagggtgactgacaacccgggtatgtgtaat 10126724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 50 - 110
Target Start/End: Original strand, 10126724 - 10126784
Alignment:
50 tttagaaggatcatggagtgagggtgactgacaacccgggtatgagtaatactgctcaaaa 110  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||    
10126724 tttagaatgatcatggagtgagggtgactgacaacccgggtatgagtaatactgctcaaaa 10126784  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University