View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5777_low_13 (Length: 251)
Name: NF5777_low_13
Description: NF5777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5777_low_13 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 15 - 251
Target Start/End: Original strand, 31126291 - 31126527
Alignment:
| Q |
15 |
aatcatataccgaaggatgtaaaattggcaaaactattcgaaaaacgggacaaatccaacacataaatcatcaataacacaaggctttgcccctgcttca |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31126291 |
aatcatataccgaaggatgtaaaattggcaaaactattcaaaaaacgggacaaatccaacacataaatcatcaataacacaaggctttgcccctgcttca |
31126390 |
T |
 |
| Q |
115 |
ctcaatataaacaaacaattaacgattcattcatattgcataagaaaaccctacattatatacttcatcaacaacaaaaacaacactaaaattcccccca |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31126391 |
ctcaatataaacaaacaattaacgattcattcatattgcataagaaaaccctacattatatacttcatcaacaacaaaaacaacactaaaattcccccaa |
31126490 |
T |
 |
| Q |
215 |
aaaaataattagaaaacttacgtgtcgtgttggagaa |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31126491 |
aaaaataattagaaaacttacgtgtcgtgttggagaa |
31126527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University