View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5777_low_14 (Length: 249)
Name: NF5777_low_14
Description: NF5777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5777_low_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 30219553 - 30219310
Alignment:
| Q |
1 |
ctaccttgattttgattgatacataaatgctgattgtacacttcttagttcttacttttactttttgatgaaaagtatgatttggaatttgaagctcgag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30219553 |
ctaccttgattttgattgatacataaatgctgattgtacacttcttagttcttacttttactttttgatgaaaagtatgatttggaatttgaagctcgag |
30219454 |
T |
 |
| Q |
101 |
caaggccatagaatcatgtacattacttccgtattatatatttggatggagcgcagtaataatgttctctttaaaggcaaagttgaaaattaattggagg |
200 |
Q |
| |
|
|||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |
|
|
| T |
30219453 |
caagaccatagaatgatgtacattacttccgtattatatatttggatggagcgcagtaataatgttctctttaaaggcaaagttgtaaattatttggagg |
30219354 |
T |
 |
| Q |
201 |
tggt------cataaagcgtctatcgtggttttggttcatattg |
238 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
30219353 |
tggtcgatcgcataaagcgtctatggtggttttggttcatattg |
30219310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University