View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5777_low_8 (Length: 348)
Name: NF5777_low_8
Description: NF5777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5777_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 83; Significance: 3e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 10126626 - 10126724
Alignment:
| Q |
1 |
tttcatgctctcataacttccaagaagaaagtgaatcgaatttactccctttagaaggatcatggagtgagggtgactgacaacccgggtatgagtaat |
99 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10126626 |
tttcatgctccgatgacttccaagaagaaagtgaatcgaatttactccctttagaaggatcatggagtgagggtgactgacaacccgggtatgtgtaat |
10126724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 50 - 110
Target Start/End: Original strand, 10126724 - 10126784
Alignment:
| Q |
50 |
tttagaaggatcatggagtgagggtgactgacaacccgggtatgagtaatactgctcaaaa |
110 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10126724 |
tttagaatgatcatggagtgagggtgactgacaacccgggtatgagtaatactgctcaaaa |
10126784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University