View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5778-Insertion-5 (Length: 227)
Name: NF5778-Insertion-5
Description: NF5778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5778-Insertion-5 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 8 - 227
Target Start/End: Complemental strand, 6685422 - 6685203
Alignment:
| Q |
8 |
ggtccttcgtcgaaaaacagaaggaatgaactgcttcaattctcaataaccaaattatgttttccaatttacatgctgaatgcatagtcgacttcgatcc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
6685422 |
ggtccttcgtcgaaaaacagaaggaatgaactgcttcagttctcaataaccaaattatgttttccaatttacatgatgaatgcatagtcgacttcgatcc |
6685323 |
T |
|
| Q |
108 |
tagtgaaagaatacatgtattttcgttgttcaatgtttgtagaattcttagcaacgtctgtttgtggtggatgtcttcgaacaggggaggaattgttttt |
207 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6685322 |
tagtgaaagaatacatgtgttttcgttgttcaatgtttgtagaattcttaacaacgtctatttgtggtggatgtcttcgaaaaggggaggaattgttttt |
6685223 |
T |
|
| Q |
208 |
cgccgttgatttcgccataa |
227 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6685222 |
cgccgttgatttcgccataa |
6685203 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University