View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5778_high_4 (Length: 332)
Name: NF5778_high_4
Description: NF5778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5778_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 2e-49; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 12 - 115
Target Start/End: Original strand, 8322745 - 8322848
Alignment:
| Q |
12 |
tagaatcttaactgtctgttccttctcaaaatcttgacaccttgatcgtatgcttaaattttatggatcagttctaaggatagacgatcttatggatcaa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8322745 |
tagaatcttaactgtctgttccttctcaaaatcttgacactttgatcgtatgcttaaattttatggatcagttctaaggatagacgatcttatggatcaa |
8322844 |
T |
 |
| Q |
112 |
atgg |
115 |
Q |
| |
|
|||| |
|
|
| T |
8322845 |
atgg |
8322848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University