View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5779-Insertion-9 (Length: 217)
Name: NF5779-Insertion-9
Description: NF5779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5779-Insertion-9 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 4 - 217
Target Start/End: Complemental strand, 47508914 - 47508704
Alignment:
| Q |
4 |
aacattaaagatagccagccatctaactcataaattaacagagaatggtgaatagatcttccggtattgctcatatcttgttatataattttttctcaaa |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47508914 |
aacattaaagatagccagccatctaactcataaattaacagagattgctgaatagatcttccggtattgctcatatcttgttatataattttttctcaaa |
47508815 |
T |
 |
| Q |
104 |
gaactgatcagaagttatcctccgatgaatgttttgagggnnnnnnnggagtaatggagggggtttgtacaacaataatctaaattaataatcaagaaga |
203 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||| | ||||||| ||||||||||||||||||||||||||||||||| || |||| |
|
|
| T |
47508814 |
gaactgatcagaagttatcttccgatgagtgttttgaggggttttttgcagtaatgcagggggtttgtacaacaataatctaaattaatactc---aaga |
47508718 |
T |
 |
| Q |
204 |
ggataaagtagtga |
217 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
47508717 |
ggataaagtagtga |
47508704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University