View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5781-Insertion-11 (Length: 145)

Name: NF5781-Insertion-11
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5781-Insertion-11
NF5781-Insertion-11
[»] chr8 (1 HSPs)
chr8 (6-145)||(34506586-34506725)


Alignment Details
Target: chr8 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 6 - 145
Target Start/End: Complemental strand, 34506725 - 34506586
Alignment:
6 caattttgacatgtttcttaatgttgaacctaatggtccattgatattttgggtttttcctatggcaatgtcaccaattgctatgattgaaactccacat 105  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34506725 caattttgacatgtttcttaatgttgaacctaatggtccattgatattttgggtttttcctatggcaatgtcaccaattgctatgattgaaactccacat 34506626  T
106 gcatgtaagggacgttgccttgaactcattcttcttgttg 145  Q
    ||||||||||||||||||||||||||||||||||||||||    
34506625 gcatgtaagggacgttgccttgaactcattcttcttgttg 34506586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University