View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5781-Insertion-11 (Length: 145)
Name: NF5781-Insertion-11
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5781-Insertion-11 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 6 - 145
Target Start/End: Complemental strand, 34506725 - 34506586
Alignment:
| Q |
6 |
caattttgacatgtttcttaatgttgaacctaatggtccattgatattttgggtttttcctatggcaatgtcaccaattgctatgattgaaactccacat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34506725 |
caattttgacatgtttcttaatgttgaacctaatggtccattgatattttgggtttttcctatggcaatgtcaccaattgctatgattgaaactccacat |
34506626 |
T |
 |
| Q |
106 |
gcatgtaagggacgttgccttgaactcattcttcttgttg |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34506625 |
gcatgtaagggacgttgccttgaactcattcttcttgttg |
34506586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University