View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5781-Insertion-12 (Length: 137)
Name: NF5781-Insertion-12
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5781-Insertion-12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 3e-40; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 3e-40
Query Start/End: Original strand, 8 - 126
Target Start/End: Complemental strand, 37863749 - 37863631
Alignment:
| Q |
8 |
gttgcaccttgcaagtatcacaacgtcaacataaattattattnnnnnnnnnctcacaacaatagcgagtaaattctgaaaattgtaatcagtcttattc |
107 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
37863749 |
gttgcaccttgcaagaatcacaacgtcaacataaattattattaaaaaaaaactcacaacaatagcgagtaaattctgaaaattgtaattagtcttattc |
37863650 |
T |
 |
| Q |
108 |
tttcttcacccacacccac |
126 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
37863649 |
tttcttcacccacacccac |
37863631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University