View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5781_high_22 (Length: 311)
Name: NF5781_high_22
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5781_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 45 - 295
Target Start/End: Complemental strand, 39688257 - 39688006
Alignment:
| Q |
45 |
acgatgacgaattcattcgaacctactttaccaattgagttaaaatcacggg-acaataaaaacatgattgataaaaggttacacatgtcgtttaaataa |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39688257 |
acgatgacgaattcattcgaacctactttaccaattgagttaaaatcacggggacaataaaaacatgattgataaaaggttacacatgtcgtttaaataa |
39688158 |
T |
 |
| Q |
144 |
ttaaaattaacctaatataaattgattttgttatcttctagtgaaactcactcactaactgatgggaagggaaaaatttacacctgcaaattaaatgtct |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39688157 |
ttaaaattaacctaatataaattgattttgttatcttctagtgaaactcactcactaactgatgggaagggaaaaatttacacctgcaaattaaatgtct |
39688058 |
T |
 |
| Q |
244 |
ttgcaatctttcactaagtaatcaactttgttggatgtactcataaccttat |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
39688057 |
ttgcaatctttcactaagtaatcaactttgttggatgtattcataaccttat |
39688006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University