View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5781_high_26 (Length: 264)
Name: NF5781_high_26
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5781_high_26 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 7 - 264
Target Start/End: Complemental strand, 39688635 - 39688368
Alignment:
| Q |
7 |
tagattattcttgcacttatgaacttagttattttgaatgggaaatcct---gctaatccataagcaacggagtgatgtcaatgcaagaaacaacatgtg |
103 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
39688635 |
tagattcttcttgcacttatgaacttagttattttgaatgggaaatccttatgctaatccataagcaacggagtgatgtcaatgtaagaaacaacatgtg |
39688536 |
T |
|
| Q |
104 |
gatgtgtcggtgcaagtatatagcagatcaaaaagaggcca-------actaacaatgttggtgggttgggttgaattgagtgctcaatttcagtacttt |
196 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
39688535 |
gatgtgtcggtgcaagtatatagaagatcaaaaagaggccaactagcaactaacaatgttggtgggttaggttgaattgagtgctcaatttcagtacttt |
39688436 |
T |
|
| Q |
197 |
tatgtggggtgtgtaatacagttatagtaagtggaagatacacttccgtgatgaacaaaaacatgatt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39688435 |
tatgtggggtgtgtaatacagttatagtaagtggaagatacacttccgtgatgaacaaaaacatgatt |
39688368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University