View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5781_high_27 (Length: 262)
Name: NF5781_high_27
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5781_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 161; Significance: 6e-86; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 161; E-Value: 6e-86
Query Start/End: Original strand, 25 - 249
Target Start/End: Original strand, 40423737 - 40423958
Alignment:
| Q |
25 |
ccaaagaatgaaggaggaagtgttggtaacgtaaaaaacgaaatgggaccaaaagtcaggtttttggtaa---------atgttcaagtgtcttccatta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
40423737 |
ccaaagaatgaaggaggaagtgttggtaacgtaaaaaacgaaatgggaccaaaagtcaggtttttggtaagtttggtaaatgttcaagtgtcttccatta |
40423836 |
T |
 |
| Q |
116 |
ttacaaaggtcccattttgttaggtattttccattcaatacgaccaagatcatgacgtttgcgtgtcagctcaagttccgtctcccttttcgctgtgttt |
215 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40423837 |
ttacaaaggtcccattt------------tccattcaatacgaccaagatcatgacgtttgcgtgtcagctcaagttccgtctcccttttcgctgtgttt |
40423924 |
T |
 |
| Q |
216 |
ttgatctataatgtcctttattaaatgcccattc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40423925 |
ttgatctataatgtcctttattaaatgcccattc |
40423958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University