View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5781_high_28 (Length: 251)
Name: NF5781_high_28
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5781_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 213
Target Start/End: Complemental strand, 46771342 - 46771140
Alignment:
| Q |
11 |
cagagaccagctacaacagtacaattgcccggtccaaaatttaagaacatattgtgatatattttcaatttcattgtatttatttcataaggatgtcaag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46771342 |
cagagaccagctacaacagtacaattgcccggtccaaaatttaagaacatattgtgatatattttcaatttcattgtatttatttcataaggatgtcaag |
46771243 |
T |
 |
| Q |
111 |
ctcaagcaattctatactgtatcaatactatactagatagatattcttttgtttttcatgtcaatgcaagctttgaccaaattaatatatttggaatttc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46771242 |
ctcaagcaattctatactgtatcaatactataatagatagatattcttttgtttttcatgtcaatgcaagctttgaccaaattaatatatttggaatttc |
46771143 |
T |
 |
| Q |
211 |
atg |
213 |
Q |
| |
|
||| |
|
|
| T |
46771142 |
atg |
46771140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 217 - 251
Target Start/End: Complemental strand, 46771098 - 46771064
Alignment:
| Q |
217 |
ggtgtataaatagtaatttctgcagtctttctcac |
251 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |
|
|
| T |
46771098 |
ggtgtaaaaatagtaatttctgcagtctttctcac |
46771064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University