View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5781_low_15 (Length: 450)
Name: NF5781_low_15
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5781_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 265; Significance: 1e-148; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 19 - 299
Target Start/End: Original strand, 43208606 - 43208886
Alignment:
| Q |
19 |
ttatgtggattaggacatgaaaatatcatatgcatgtagaggataggatttgtctcttaatataccttttattatcttcatggacagtgtcattgctcga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
43208606 |
ttatgtggattaggacatgaaaatatcatatgcatgtagaggataggatttgtctcttaatataccttttattatcttcatggacagtgtcattgctcaa |
43208705 |
T |
|
| Q |
119 |
attcaacctttctgatgcccacgagttttgggatgggtgacttctaaattctaatcagtcaggtatagcatttggcactcatcaatcttgctctttattt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43208706 |
attcaacctttctgatgcccacgagttttgggatgggtgacttctaaattctaatcagttaggtatagcatttggcactcatcaatcttgctctttattt |
43208805 |
T |
|
| Q |
219 |
gccagccatttgaattctgctttgtgatatgtctgcgtgttttgttctgtttgtgttgttgtcttagtgatagattatgac |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
43208806 |
gccagccatttgaattctgctttgtgatatgtctgcgtgttttgttctgtttgtgttgctgtctgagtgatagattatgac |
43208886 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 181; E-Value: 1e-97
Query Start/End: Original strand, 43 - 299
Target Start/End: Original strand, 43188279 - 43188535
Alignment:
| Q |
43 |
atcatatgcatgtagaggataggatttgtctcttaatataccttttattatcttcatggacagtgtcattgctcgaattcaacctttctgatgcccacga |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
43188279 |
atcatatgcatgtagaggataggatttgtctcttaatatgccttttattatcttcatggacagtttcattgctcgaattcaacctttctgatgcccgcat |
43188378 |
T |
|
| Q |
143 |
gttttgggatgggtgacttctaaattctaatcagtcaggtatagcatttggcactcatcaatcttgctctttatttgccagccatttgaattctgctttg |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||||||||| | |||||||||||||||||||||||||| ||||||||||||| ||||| |
|
|
| T |
43188379 |
gttttgggatgggtgacttctaaattctaatcagctaggtgtagcatttgcccctcatcaatcttgctctttatttgccggccatttgaattcaactttg |
43188478 |
T |
|
| Q |
243 |
tgatatgtctgcgtgttttgttctgtttgtgttgttgtcttagtgatagattatgac |
299 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||||||||| || |||||| ||||| |
|
|
| T |
43188479 |
tgatacttctgtgtgttttgttctgtttgtgttgttgtcttggttatagatgatgac |
43188535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 364 - 440
Target Start/End: Original strand, 43208951 - 43209027
Alignment:
| Q |
364 |
ccctttctaatcgaccgtgattggtgccgttgaccttctaataaatgtttcaaggtatcccacaatttagccctttg |
440 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43208951 |
ccctttctaatcgaccgtgattggtgccgttgaccttctaataaatgtttcaaggtatcccacaatttagccctttg |
43209027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 19 - 50
Target Start/End: Original strand, 43187857 - 43187888
Alignment:
| Q |
19 |
ttatgtggattaggacatgaaaatatcatatg |
50 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43187857 |
ttatgtggattaggacatgaaaatatcatatg |
43187888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 364 - 414
Target Start/End: Original strand, 43188600 - 43188650
Alignment:
| Q |
364 |
ccctttctaatcgaccgtgattggtgccgttgaccttctaataaatgtttc |
414 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
43188600 |
ccctttctaatcgatcgtgattggtgttgttgacctcctaatagatgtttc |
43188650 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University