View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5781_low_24 (Length: 297)
Name: NF5781_low_24
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5781_low_24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 72 - 285
Target Start/End: Complemental strand, 8005682 - 8005469
Alignment:
| Q |
72 |
cctgtatgaaaaatatatttgttagcttttatcatgtaatgattatctttacttagtttggcacataactgattaatataaagaatcaaaggtttgtttt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8005682 |
cctgtatgaaaaatatatttgttagcttttatcatgtaatgattatctttacttagtttggcacataactgattaatataaagaatcaaaggtttgtttt |
8005583 |
T |
|
| Q |
172 |
gaacaataattagataggctgaataagtgagaaagtatctattccttaatgaccttagccaatcatgcaaatttgtttctagctggtggtaaaagaattg |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8005582 |
gaacaataattagataggctgaataagtgagaaagtatctattccttaatgaccttagccaatcatgcaaatttgtttctagctggtggtaaaagaattt |
8005483 |
T |
|
| Q |
272 |
ttgcacattctttt |
285 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
8005482 |
ttgcacattctttt |
8005469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 15 - 54
Target Start/End: Complemental strand, 8005740 - 8005701
Alignment:
| Q |
15 |
tattatactgtttgagcatgcaataaacagctataactgc |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8005740 |
tattatactgtttgagcatgcaataaacagctataactgc |
8005701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University