View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5781_low_25 (Length: 288)

Name: NF5781_low_25
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5781_low_25
NF5781_low_25
[»] chr7 (1 HSPs)
chr7 (49-136)||(6351179-6351266)


Alignment Details
Target: chr7 (Bit Score: 84; Significance: 6e-40; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 49 - 136
Target Start/End: Complemental strand, 6351266 - 6351179
Alignment:
49 aacaaaaatatagttacagagagagactaaataccaacacttatctttatgctcacctgccttgcttcttgtattccggggttcttgc 136  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
6351266 aacaaaaatatagttacagagagagactaaataccaacacttatctttatgctcacctgccttgcttcttgtatgccggggttcttgc 6351179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University