View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5781_low_31 (Length: 251)
Name: NF5781_low_31
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5781_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 128; Significance: 3e-66; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 16 - 147
Target Start/End: Original strand, 7047747 - 7047878
Alignment:
| Q |
16 |
atcatcacttttatcatttatgatcatcatatataattgtcatacctcagaaactgagaggccaagatcagtgatgatagctgattgtgtaggtgaagta |
115 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7047747 |
atcatcacttttctcatttatgatcatcatatataattgtcatacctcagaaactgagaggccaagatcagtgatgatagctgattgtgtaggtgaagta |
7047846 |
T |
 |
| Q |
116 |
taacctgcctgcaataaatgatcatagtaatt |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7047847 |
taacctgcctgcaataaatgatcatagtaatt |
7047878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 188 - 251
Target Start/End: Original strand, 7047910 - 7047973
Alignment:
| Q |
188 |
gatatattagatacatactgtaaaaccaaactgaataggacccaaagcaacaatgagaacacaa |
251 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7047910 |
gatatatttgatacatactgtaaaaccaaactgaataggacccaaagcaacaatgagaacacaa |
7047973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 210 - 250
Target Start/End: Complemental strand, 32934246 - 32934206
Alignment:
| Q |
210 |
aaaccaaactgaataggacccaaagcaacaatgagaacaca |
250 |
Q |
| |
|
|||||||| || |||||||||||||| |||||||||||||| |
|
|
| T |
32934246 |
aaaccaaattggataggacccaaagctacaatgagaacaca |
32934206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University