View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5781_low_35 (Length: 219)
Name: NF5781_low_35
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5781_low_35 |
 | |
|
| [»] scaffold0012 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0012 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 151817 - 152033
Alignment:
| Q |
1 |
atgatttttgttctgaaggtaacattttcagattctctcccacaacgtaaccactgcgatatctttttgtttttcggaagcaagtatcagatcttgctac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
151817 |
atgatttttgttctgaaggtaacattttcagattctctcccacaacgtaaccactgcgatatctttttgttttttggaagcaagtatcagatcttgctac |
151916 |
T |
|
| Q |
101 |
tcgccaattctagttattcnnnnnnnnnnnnnnnnngtcataggattgaaatttattcattcaacaagtacagacaattacccactattgagatttatag |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
151917 |
tcgccaattctagttattcttttattttatttttttgtcataggattgaaatttattcattcaacaagtacagataattacccactattgagatttatag |
152016 |
T |
|
| Q |
201 |
aaagatgatattgtttc |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
152017 |
aaagatgatattgtttc |
152033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 49 - 119
Target Start/End: Original strand, 34506666 - 34506737
Alignment:
| Q |
49 |
aaccactgcgatatctttt-tgtttttcggaagcaagtatcagatcttgctactcgccaattctagttattc |
119 |
Q |
| |
|
|||||||| |||||||||| ||| | | ||||||||||| ||||| ||||||| | |||||||||||||||| |
|
|
| T |
34506666 |
aaccactgtgatatcttttatgtatcttggaagcaagtaccagatattgctacacaccaattctagttattc |
34506737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University