View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5781_low_37 (Length: 211)
Name: NF5781_low_37
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5781_low_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 44941360 - 44941554
Alignment:
| Q |
1 |
tcacaacaaatgtttcaatgagtcgggaattaatttatttttaaattctattgttgcacatggggatcggaaataaaagtttattctggataaggatcct |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
44941360 |
tcacaacaaatgtttcaatgagttgggaattaatttatttttaaattctattgttgcacatggggatcggaaataaaagtttattctgga-----atcct |
44941454 |
T |
 |
| Q |
101 |
aactacaccttcaaaaactgccagaaatgttgattttcatgtgttttgtcagttcaactttaatgctattaatgcagaaagaagttactcttcatctcac |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
44941455 |
aactacaccttcaaaaactgccagaaatgttgattttcatgtgttttgtcagttcaactttaatgctattaatgcagaaagaagttactcttcctctcac |
44941554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University