View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5781_low_9 (Length: 527)
Name: NF5781_low_9
Description: NF5781
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5781_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 77; Significance: 2e-35; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 25 - 157
Target Start/End: Complemental strand, 29857737 - 29857604
Alignment:
| Q |
25 |
aacagaattttaatatttcactgcatctggacataataatatatgttttcccacattatccacccnnnnnnnct-aattataaagttaacttattcattt |
123 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||| ||||||||| |||||||||||||| | |||||||||||||| |||||||||| |
|
|
| T |
29857737 |
aacagaattttaatatttcactgcatcaggaaataataatctatgttttctcacattatccacccaaaaaaatttaattataaagttaatttattcattt |
29857638 |
T |
 |
| Q |
124 |
tccaatatcttgtttcatgactcagtttcctatc |
157 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
29857637 |
tccaatatcttgtttcatgattcagtttcctatc |
29857604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University