View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5782_high_21 (Length: 341)

Name: NF5782_high_21
Description: NF5782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5782_high_21
NF5782_high_21
[»] chr4 (1 HSPs)
chr4 (1-180)||(51794723-51794902)


Alignment Details
Target: chr4 (Bit Score: 147; Significance: 2e-77; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 1 - 180
Target Start/End: Complemental strand, 51794902 - 51794723
Alignment:
1 aattaacgtggtgatannnnnnngttgatgggacgttaaattgcttaaatgaatgaatattacacaaataaaaaattgtgtgaacgaagagaagtggaaa 100  Q
    ||||||||||||||||       |||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51794902 aattaacgtggtgatatttttttgttgatgggatgttaaattgcgtaaatgaatgaatattacacaaataaaaaattgtgtgaacgaagagaagtggaaa 51794803  T
101 cctagagggagcttgggttcatgggatgtgatatgcgagtagatcgtttgtatttcttaaatagaggtttaatatataat 180  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
51794802 cctagagggagcttgggttcatgggatgtgatatgcgagtagatcgtttgtatttctcaaatagaggtttaatatataat 51794723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University