View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5782_low_24 (Length: 303)
Name: NF5782_low_24
Description: NF5782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5782_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 21 - 284
Target Start/End: Complemental strand, 38360007 - 38359743
Alignment:
| Q |
21 |
tgaaaagtttcaggtgattttgagaatgtgaaacaaccagg-ccaaatgtcataagagaaagtgcattcaaggaacatgtgagattgagtttcttgattt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38360007 |
tgaaaagtttcaggtgattttgagaatgtgaaacaaccaggaccaaatgtcataagagaaagtgcattcacggaacatgtgagattgagtttcttgattt |
38359908 |
T |
 |
| Q |
120 |
ttccacaaagagaacaaatagagggaagcaaacaacctcttttcgcaagaatgtcatatgtggggagcttgttgagaagaatcctccaaacaagaagagg |
219 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38359907 |
ttccacaaagagaaaaaatagagggaagcaaacaacctcttttcgcaagaatgtcatctgtggggagcttgttgagaagaatcctccaaacaagaagagg |
38359808 |
T |
 |
| Q |
220 |
cttggaggggggcaatagtagcatgccaaatagtttcagcgcaactaatgttttgaggatgaggg |
284 |
Q |
| |
|
||||||||||| |||||| ||||| |||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
38359807 |
cttggagggggacaatagcagcattacaaatagttttagcccaactaatgttttgaggatgaggg |
38359743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University