View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5782_low_30 (Length: 285)
Name: NF5782_low_30
Description: NF5782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5782_low_30 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 48; Significance: 2e-18; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 187
Target Start/End: Original strand, 21205245 - 21205308
Alignment:
| Q |
124 |
ccaaacttcaaggtgttacttcttcctttgctcatgtttttggttgttttgtttatatgtcttg |
187 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
21205245 |
ccaaactccaaggttttacttcttcctttgctcatgtttctggttgttttatttatatgtcttg |
21205308 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 121 - 173
Target Start/End: Original strand, 21155423 - 21155475
Alignment:
| Q |
121 |
gaaccaaacttcaaggtgttacttcttcctttgctcatgtttttggttgtttt |
173 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
21155423 |
gaaccaaactccaaggtgttacttcttcctttgctcatgtttctggttgtttt |
21155475 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 132 - 187
Target Start/End: Original strand, 21189196 - 21189251
Alignment:
| Q |
132 |
caaggtgttacttcttcctttgctcatgtttttggttgttttgtttatatgtcttg |
187 |
Q |
| |
|
||||||||||||||||| ||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
21189196 |
caaggtgttacttcttcatttgctcatgtttctagttgttttatttatatgtcttg |
21189251 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 146 - 186
Target Start/End: Original strand, 21295904 - 21295944
Alignment:
| Q |
146 |
ttcctttgctcatgtttttggttgttttgtttatatgtctt |
186 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
21295904 |
ttcctttgctcatgtttttggttgttttatttatatatctt |
21295944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University