View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5782_low_32 (Length: 283)

Name: NF5782_low_32
Description: NF5782
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5782_low_32
NF5782_low_32
[»] chr4 (7 HSPs)
chr4 (13-253)||(5883878-5884118)
chr4 (185-241)||(5845770-5845826)
chr4 (13-78)||(24719841-24719906)
chr4 (14-48)||(7452772-7452806)
chr4 (13-46)||(10143166-10143199)
chr4 (13-46)||(37240505-37240538)
chr4 (21-77)||(21314869-21314925)
[»] chr7 (3 HSPs)
chr7 (13-76)||(21157493-21157556)
chr7 (13-70)||(5058794-5058858)
chr7 (13-46)||(1977814-1977847)
[»] chr3 (3 HSPs)
chr3 (15-77)||(6861003-6861065)
chr3 (13-46)||(17064573-17064606)
chr3 (21-53)||(27090645-27090677)
[»] chr5 (2 HSPs)
chr5 (13-63)||(17624867-17624917)
chr5 (13-77)||(26021585-26021648)
[»] chr1 (2 HSPs)
chr1 (13-70)||(18304617-18304674)
chr1 (13-47)||(25146597-25146631)
[»] chr6 (1 HSPs)
chr6 (13-47)||(15528107-15528141)
[»] scaffold0007 (1 HSPs)
scaffold0007 (15-48)||(220445-220478)
[»] scaffold0027 (1 HSPs)
scaffold0027 (12-44)||(132947-132979)


Alignment Details
Target: chr4 (Bit Score: 225; Significance: 1e-124; HSPs: 7)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 13 - 253
Target Start/End: Complemental strand, 5884118 - 5883878
Alignment:
13 aaaatccttcgatttcgattgcgattttacgattttgctattcccttttgatctgaagcaaaatcttaagggttttagtaaatgtataatatctaataaa 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
5884118 aaaatccttcgatttcgattgcgattttacgattttgctattcccttttgatctgaagcaaaatcttaagggttttagtaaatgtataatatctaataaa 5884019  T
113 cttgtgcaattgctctgagttcaatgtggatgatctccaatctcacctcgtgatccaacaagcacaacatctaaaatcttaattcaaccaatttaattaa 212  Q
    |||||| |||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||    
5884018 cttgtgtaattgctctgagttcaatgtggatgatccccaatctcacctcgtgatccaagaagcacaacatccaaaatcttaattcaaccaatttaattaa 5883919  T
213 taaattcttttcatggttaataaagtctttagctttcccct 253  Q
    |||||||||||||||||||||||||||||||||||||||||    
5883918 taaattcttttcatggttaataaagtctttagctttcccct 5883878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 185 - 241
Target Start/End: Complemental strand, 5845826 - 5845770
Alignment:
185 aaaatcttaattcaaccaatttaattaataaattcttttcatggttaataaagtctt 241  Q
    ||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||    
5845826 aaaatcttaattcaaccaattaaattaataaattattttcatggttaataaagtctt 5845770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 13 - 78
Target Start/End: Original strand, 24719841 - 24719906
Alignment:
13 aaaatccttcgatttcgattgcgattttacgattttgctattcccttttgatctgaagcaaaatct 78  Q
    ||||||||||||||  |||| ||||||| |||||||||| |||||||| || ||||||||||||||    
24719841 aaaatccttcgattgtgatttcgatttttcgattttgctcttccctttcgacctgaagcaaaatct 24719906  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 14 - 48
Target Start/End: Original strand, 7452772 - 7452806
Alignment:
14 aaatccttcgatttcgattgcgattttacgatttt 48  Q
    |||||||||||||| ||||||||||||||||||||    
7452772 aaatccttcgattttgattgcgattttacgatttt 7452806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 46
Target Start/End: Original strand, 10143166 - 10143199
Alignment:
13 aaaatccttcgatttcgattgcgattttacgatt 46  Q
    ||||||||||||||| ||||||||||||||||||    
10143166 aaaatccttcgattttgattgcgattttacgatt 10143199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 46
Target Start/End: Original strand, 37240505 - 37240538
Alignment:
13 aaaatccttcgatttcgattgcgattttacgatt 46  Q
    ||||||||||||||| ||||||||||||||||||    
37240505 aaaatccttcgattttgattgcgattttacgatt 37240538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 77
Target Start/End: Complemental strand, 21314925 - 21314869
Alignment:
21 tcgatttcgattgcgattttacgattttgctattcccttttgatctgaagcaaaatc 77  Q
    ||||||| | |||| ||||| |||||||||||| ||||||  |||||||||||||||    
21314925 tcgattttggttgcaatttttcgattttgctatcccctttcaatctgaagcaaaatc 21314869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 13 - 76
Target Start/End: Complemental strand, 21157556 - 21157493
Alignment:
13 aaaatccttcgatttcgattgcgattttacgattttgctattcccttttgatctgaagcaaaat 76  Q
    |||||||||| |||| ||||| |||||||||||||||||||||||||||||||||||| |||||    
21157556 aaaatccttcaattttgattgagattttacgattttgctattcccttttgatctgaagtaaaat 21157493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 70
Target Start/End: Original strand, 5058794 - 5058858
Alignment:
13 aaaatccttcgatttcgattgcgattttacga-------ttttgctattcccttttgatctgaag 70  Q
    ||||||||||||||| |||||| |||||||||       ||||||||||||||||||||||||||    
5058794 aaaatccttcgattttgattgcaattttacgaattccgattttgctattcccttttgatctgaag 5058858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 46
Target Start/End: Original strand, 1977814 - 1977847
Alignment:
13 aaaatccttcgatttcgattgcgattttacgatt 46  Q
    ||||||||||||||| ||||||||||||||||||    
1977814 aaaatccttcgattttgattgcgattttacgatt 1977847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 3)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 15 - 77
Target Start/End: Complemental strand, 6861065 - 6861003
Alignment:
15 aatccttcgatttcgattgcgattttacgattttgctattcccttttgatctgaagcaaaatc 77  Q
    ||||| ||||||| ||||||||||||| |||||| ||||||||||| || |||||||||||||    
6861065 aatccatcgattttgattgcgattttatgattttactattccctttcgacctgaagcaaaatc 6861003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 13 - 46
Target Start/End: Original strand, 17064573 - 17064606
Alignment:
13 aaaatccttcgatttcgattgcgattttacgatt 46  Q
    ||||||||||||||| ||||||||||||||||||    
17064573 aaaatccttcgattttgattgcgattttacgatt 17064606  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 21 - 53
Target Start/End: Original strand, 27090645 - 27090677
Alignment:
21 tcgatttcgattgcgattttacgattttgctat 53  Q
    ||||||| |||||||||||||||||||||||||    
27090645 tcgattttgattgcgattttacgattttgctat 27090677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 35; Significance: 0.0000000001; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 13 - 63
Target Start/End: Original strand, 17624867 - 17624917
Alignment:
13 aaaatccttcgatttcgattgcgattttacgattttgctattcccttttga 63  Q
    |||||| || ||||| ||||||||||||||||||||||||||| |||||||    
17624867 aaaatcttttgattttgattgcgattttacgattttgctattctcttttga 17624917  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 13 - 77
Target Start/End: Original strand, 26021585 - 26021648
Alignment:
13 aaaatccttcgatttcgattgcgattttacgattttgctattcccttttgatctgaagcaaaatc 77  Q
    |||||||| |||||| ||||| |||||| |||||||||| ||||||||||  |||||||||||||    
26021585 aaaatcctacgattttgattgtgatttt-cgattttgctcttcccttttggcctgaagcaaaatc 26021648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 70
Target Start/End: Complemental strand, 18304674 - 18304617
Alignment:
13 aaaatccttcgatttcgattgcgattttacgattttgctattcccttttgatctgaag 70  Q
    ||||||||||||||| || |||||||||||||||||||| || ||||| || ||||||    
18304674 aaaatccttcgattttgaatgcgattttacgattttgctttttcctttcgacctgaag 18304617  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 47
Target Start/End: Complemental strand, 25146631 - 25146597
Alignment:
13 aaaatccttcgatttcgattgcgattttacgattt 47  Q
    ||||||||||||||| |||||||||||||||||||    
25146631 aaaatccttcgattttgattgcgattttacgattt 25146597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 47
Target Start/End: Complemental strand, 15528141 - 15528107
Alignment:
13 aaaatccttcgatttcgattgcgattttacgattt 47  Q
    ||||||| |||||||||||||||||||||||||||    
15528141 aaaatccatcgatttcgattgcgattttacgattt 15528107  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0007 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0007
Description:

Target: scaffold0007; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 15 - 48
Target Start/End: Complemental strand, 220478 - 220445
Alignment:
15 aatccttcgatttcgattgcgattttacgatttt 48  Q
    |||||||||||||||||||| |||||||||||||    
220478 aatccttcgatttcgattgcaattttacgatttt 220445  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0027 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0027
Description:

Target: scaffold0027; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 12 - 44
Target Start/End: Complemental strand, 132979 - 132947
Alignment:
12 gaaaatccttcgatttcgattgcgattttacga 44  Q
    |||||||||||||||| ||||||||||||||||    
132979 gaaaatccttcgattttgattgcgattttacga 132947  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University