View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5784-Insertion-11 (Length: 120)
Name: NF5784-Insertion-11
Description: NF5784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5784-Insertion-11 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 109; Significance: 3e-55; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 109; E-Value: 3e-55
Query Start/End: Original strand, 8 - 120
Target Start/End: Complemental strand, 41747628 - 41747516
Alignment:
| Q |
8 |
ataggatgtttgcctatagcaactgagaatacttcgtatgagaaatgcaatgggactttgaacacggtagccatgaatcacaatcacttgttactccaag |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41747628 |
ataggatgtttgcctatagcaactgagaatacttcgtatgagaaatgcaatgggactttgaacacggtagccatgaatcacaatcacttgttactccaag |
41747529 |
T |
 |
| Q |
108 |
ctgtgaaagaact |
120 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
41747528 |
ctgtggaagaact |
41747516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 77 - 120
Target Start/End: Complemental strand, 41739352 - 41739309
Alignment:
| Q |
77 |
gccatgaatcacaatcacttgttactccaagctgtgaaagaact |
120 |
Q |
| |
|
||||||||||||||| ||||||| |||||||||||| ||||||| |
|
|
| T |
41739352 |
gccatgaatcacaattacttgttgctccaagctgtggaagaact |
41739309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University