View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5784_high_9 (Length: 267)
Name: NF5784_high_9
Description: NF5784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5784_high_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 12 - 249
Target Start/End: Original strand, 32640756 - 32640993
Alignment:
| Q |
12 |
agagaaaaacaaatttgtaatgnnnnnnnnnntgtagtaacacctttgttaaaatatggatagatttggaatatatttggatgtagtccggctggttttg |
111 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32640756 |
agagaaaaacaaatttgtaatgaaaaaaaaaatgtagttacacctttgttaaaatatggatagatttggaatatatttggatgtagtccggctggttttg |
32640855 |
T |
|
| Q |
112 |
tggaatggaagccatacatgccctcggatatcccaatagagacaaagaaattgtatccaaaaagtctctaatacaaattaatatattgacgatccggttg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32640856 |
tggaatggaagccatacatgccctcggatatcccaatagagacaaagaaattgtatccaaaaagtctctaatacaaattaatatatttacgatccggttg |
32640955 |
T |
|
| Q |
212 |
cacttcttcattgtaggggactcaaattaacactagtt |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32640956 |
cacttcttcattgtaggggactcaaattaacactagtt |
32640993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University