View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5784_low_9 (Length: 269)
Name: NF5784_low_9
Description: NF5784
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5784_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 171; Significance: 7e-92; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 171; E-Value: 7e-92
Query Start/End: Original strand, 71 - 268
Target Start/End: Complemental strand, 18169579 - 18169381
Alignment:
| Q |
71 |
ttttatcaaatattttattatgattttttcgacagaataattttagattgaaatggtattagctaaa-attttattttcaaattctatttttgccagaaa |
169 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
18169579 |
ttttatcaaatattttattaaggttttttcgacaaaataattttagattgaaatggtattagctagagattttattttcaaattctatttttgccagaaa |
18169480 |
T |
 |
| Q |
170 |
catggagatatctcatgctctagaaatgcaaatggaagtagaaaggaaacttaatgaacaaattgaggtaacatatataatgtgatatcatgattaaaa |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
18169479 |
catggagatatctcatgctctagaaatgcaaatggaagtagaaaggaaacttaatgaacaaattgaggtaacatatataatgtgatatcatgaataaaa |
18169381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 5 - 91
Target Start/End: Complemental strand, 18169670 - 18169583
Alignment:
| Q |
5 |
atgaacaatgcagcagagaaatcattcaaggggaccataatcaaatcactgagtaataagtagagc-ttttatcaaatattttattat |
91 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
18169670 |
atgaacaatgcagcagagaaatcggtcaaggggaccataatcaaatcactgagtaataattagagctttttatcaaatattttattat |
18169583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 198 - 249
Target Start/End: Complemental strand, 31748739 - 31748688
Alignment:
| Q |
198 |
caaatggaagtagaaaggaaacttaatgaacaaattgaggtaacatatataa |
249 |
Q |
| |
|
|||||||||||| ||| ||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
31748739 |
caaatggaagtacaaaagaaactttatgaacaaattgaggtaacatttataa |
31748688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University