View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786-Insertion-11 (Length: 220)
Name: NF5786-Insertion-11
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786-Insertion-11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 204; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 204; E-Value: 1e-112
Query Start/End: Original strand, 8 - 217
Target Start/End: Complemental strand, 5546236 - 5546027
Alignment:
| Q |
8 |
cgttagtgtgattgttcgagaattcgaagttaataaagacaaagaaagagtagaagcmgttgaaaggacatgtgaagttggacctagtaaccaactttct |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5546236 |
cgttagtgtgattgttcgagaattcgaagttaataaagacaaagaaagagtagaagcagttgaaaggacatgtgaagttggacctagtaaccaactttct |
5546137 |
T |
|
| Q |
108 |
ctcttcaccgacatgcttggtgaccccatttgcagggtccgccactccccttcttacctcatgctggtatatattcacaaaaatcattcattttcactat |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5546136 |
ctcttcaccgacatgcttggtgaccccatttgcagggtccgccactcaccttcttacctcatgctggtatatattcacaaaaatcattcattttcactat |
5546037 |
T |
|
| Q |
208 |
tctattactt |
217 |
Q |
| |
|
|||||||||| |
|
|
| T |
5546036 |
tctattactt |
5546027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 38 - 148
Target Start/End: Original strand, 39917998 - 39918108
Alignment:
| Q |
38 |
taataaagacaaagaaagagtagaagcmgttgaaaggacatgtgaagttggacctagtaaccaactttctctcttcaccgacatgcttggtgaccccatt |
137 |
Q |
| |
|
||||||||| | |||||| || ||||| ||||||| | ||||||||||||||| ||| | ||||| |||||||||||| ||| |||||||| ||| |
|
|
| T |
39917998 |
taataaagatagagaaagtgttgaagcagttgaaaaaatatgtgaagttggacccagtggtaagctttccctcttcaccgacttgcacggtgaccctatt |
39918097 |
T |
|
| Q |
138 |
tgcagggtccg |
148 |
Q |
| |
|
||||| ||||| |
|
|
| T |
39918098 |
tgcagagtccg |
39918108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University