View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786-Insertion-12 (Length: 215)
Name: NF5786-Insertion-12
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786-Insertion-12 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 215
Target Start/End: Complemental strand, 48144710 - 48144501
Alignment:
| Q |
7 |
agaaattccatgggtaccgagtccttgttgccatgcctaaagtgatagaatatttatcttagattttgtaagaggtatacttattttagacgactaagca |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48144710 |
agaaattccatgggtaccgagtccttgttgccatgcctaaagtgatagaatatttatcttagattttgtaagaggtatacttattttagacgactaagca |
48144611 |
T |
 |
| Q |
107 |
aatataacacccctaaagcaaatagtattaagatggaattgattgattttatattttcaattgataactattacctttcaagttgaatt-cttctttaat |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48144610 |
aatataacacccctaaagcaaatagtattaagatggaattgattgattttatattttcaattgataactattacctttcaagttgaattagttctttaat |
48144511 |
T |
 |
| Q |
206 |
taatagatat |
215 |
Q |
| |
|
|||||||||| |
|
|
| T |
48144510 |
taatagatat |
48144501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University