View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786-Insertion-13 (Length: 215)
Name: NF5786-Insertion-13
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786-Insertion-13 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 8 - 215
Target Start/End: Original strand, 47323733 - 47323940
Alignment:
| Q |
8 |
accaggtgggtttggactcattagaatcctttgttataataacattggaagnnnnnnnnttgttgagttaccaaaagttgtgaaaacactttgtaacctc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47323733 |
accaggtgggtttggactcattagaatcctttgttataataacattggaagaaaaaaaattgttgagttaccaaaagttgtgaaaacactttgtaacctc |
47323832 |
T |
 |
| Q |
108 |
tcaagaccttgtgatgattggcaataccttggtatagattgtcttttattgcttctcaaggatgaaaatacaaggtacaaagttattattgatgatattg |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
47323833 |
tcaagatcttgtgatgattggcaataccttggtatagattgtcttttattgcttctcaaggatgaaaatacaaggtacaaagttattattgatgatgttg |
47323932 |
T |
 |
| Q |
208 |
atgttgtt |
215 |
Q |
| |
|
|||||||| |
|
|
| T |
47323933 |
atgttgtt |
47323940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University