View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786-Insertion-14 (Length: 122)
Name: NF5786-Insertion-14
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786-Insertion-14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 90; Significance: 6e-44; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 90; E-Value: 6e-44
Query Start/End: Original strand, 8 - 122
Target Start/End: Original strand, 32822415 - 32822529
Alignment:
| Q |
8 |
ttaggcctaaagaacaaacaaagcttgtgcagtgaaaccttagtaactcgtttccgtctgctatgcagcggggatgnnnnnnngagagatttgttgcttt |
107 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
32822415 |
ttaggcctaaagaacaaacaaaggttgtgcagtgaaaccttagtaactcgtttccgtctgctatgcagcggggatgtttttttgagagatttgttgcttt |
32822514 |
T |
|
| Q |
108 |
tgctttgattgagtc |
122 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
32822515 |
tgctttgattgagtc |
32822529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University