View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786_high_37 (Length: 254)
Name: NF5786_high_37
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786_high_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 13 - 116
Target Start/End: Complemental strand, 45063283 - 45063180
Alignment:
| Q |
13 |
aatatcagtgatgaggaaaagaacttggtaacctcttctaaatttttattcataaatcatgttgaaaatgagaagataaaaagaactcaaattaaaccca |
112 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45063283 |
aatatcagtgatgaggaaaagaactgggtaacctcttctaaatttttattcataaatcatgttgaaaatgagaagataaaaagaactcaaattaaaccca |
45063184 |
T |
 |
| Q |
113 |
aatt |
116 |
Q |
| |
|
|||| |
|
|
| T |
45063183 |
aatt |
45063180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 150 - 236
Target Start/End: Complemental strand, 45063185 - 45063099
Alignment:
| Q |
150 |
caaattgagaagatggttattttacctcgataggagtttgaaggcaaaatgttgcgccacaaaactttaattcaacccacaaaagtg |
236 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
45063185 |
caaattgagaacatggttattttacctcgaaaggagtttgaaggcaaaatgttgcgccacaaaacttcaattcaacccaaaaaagtg |
45063099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University