View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF5786_high_38 (Length: 250)

Name: NF5786_high_38
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF5786_high_38
NF5786_high_38
[»] chr5 (1 HSPs)
chr5 (13-250)||(12634510-12634747)
[»] chr8 (2 HSPs)
chr8 (122-250)||(31151399-31151524)
chr8 (13-88)||(31151651-31151726)
[»] scaffold0599 (2 HSPs)
scaffold0599 (122-243)||(3044-3165)
scaffold0599 (18-83)||(2847-2912)
[»] scaffold0042 (2 HSPs)
scaffold0042 (122-243)||(11434-11555)
scaffold0042 (18-83)||(11687-11752)
[»] chr3 (2 HSPs)
chr3 (122-243)||(11911350-11911471)
chr3 (18-83)||(11911153-11911218)
[»] chr7 (2 HSPs)
chr7 (122-243)||(37960068-37960186)
chr7 (15-84)||(37959868-37959937)


Alignment Details
Target: chr5 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 12634747 - 12634510
Alignment:
13 aatatggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaatgtgaattcacttactaacaaatgaaatt 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
12634747 aatatggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaatgtgaattcacttactaacaaatgaaatt 12634648  T
113 actcaattctgataggatgccgtacgtgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattatattgaatgg 212  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
12634647 actcaattctgataggatgccgtacatgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattataatgaatgg 12634548  T
213 gaagaagaaatccaaaggtaagagtaataacaacataa 250  Q
    ||||||||||||||||||||||||||||||| ||||||    
12634547 gaagaagaaatccaaaggtaagagtaataaccacataa 12634510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 122 - 250
Target Start/End: Complemental strand, 31151524 - 31151399
Alignment:
122 tgataggatgccgtacgtgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattatattgaatgggaagaagaa 221  Q
    |||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||| ||||||||||||||||||||  |||||||||   ||||    
31151524 tgataggatgccgtacgtgaacaatgatgtttatcttgagcttgcaaagttagattacaactattgtcaagcaatgcattatgatgaatggga---agaa 31151428  T
222 atccaaaggtaagagtaataacaacataa 250  Q
    |||||||||||||| ||| ||| ||||||    
31151427 atccaaaggtaagaataaaaaccacataa 31151399  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 13 - 88
Target Start/End: Complemental strand, 31151726 - 31151651
Alignment:
13 aatatggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaatgtga 88  Q
    |||||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||    
31151726 aatatggtggcgaaaatgatgtttggattggtaagaccctttacaggtaagaatcttaattttacattgaatgtga 31151651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0599 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: scaffold0599
Description:

Target: scaffold0599; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 243
Target Start/End: Original strand, 3044 - 3165
Alignment:
122 tgataggatgccgtacgtgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattatattgaatgggaagaagaa 221  Q
    |||||||||||||||| ||| ||||||| |||| || |||||||||||||| ||||||||||||||||||||||||||||||  ||||||| ||||||||    
3044 tgataggatgccgtacatgaccaatgatgtttaacttgagcttgcaaagttggattacaacaattgtcaagcaatgcattatgatgaatggaaagaagaa 3143  T
222 atccaaaggtaagagtaataac 243  Q
    ||||||||||||| ||| ||||    
3144 atccaaaggtaagggtagtaac 3165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0599; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 2847 - 2912
Alignment:
18 ggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaa 83  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
2847 ggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagaatcttaattttacattgaa 2912  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0042 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: scaffold0042
Description:

Target: scaffold0042; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 243
Target Start/End: Complemental strand, 11555 - 11434
Alignment:
122 tgataggatgccgtacgtgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattatattgaatgggaagaagaa 221  Q
    |||||||||||||||| ||| ||||||| |||| || |||||||||||||| ||||||||||||||||||||||||||||||  ||||||| ||||||||    
11555 tgataggatgccgtacatgaccaatgatgtttatcttgagcttgcaaagttggattacaacaattgtcaagcaatgcattatgatgaatggaaagaagaa 11456  T
222 atccaaaggtaagagtaataac 243  Q
    ||||||||||||| ||| ||||    
11455 atccaaaggtaagggtagtaac 11434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0042; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 18 - 83
Target Start/End: Complemental strand, 11752 - 11687
Alignment:
18 ggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaa 83  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
11752 ggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagaatcttaattttacattgaa 11687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 78; Significance: 2e-36; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 122 - 243
Target Start/End: Original strand, 11911350 - 11911471
Alignment:
122 tgataggatgccgtacgtgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattatattgaatgggaagaagaa 221  Q
    |||||||||||||||| ||  ||||||| ||||||| |||||||||||||| ||||||||||||||||||||||||||||||  ||||||| ||||||||    
11911350 tgataggatgccgtacatggccaatgatgtttaccttgagcttgcaaagttggattacaacaattgtcaagcaatgcattatgatgaatggaaagaagaa 11911449  T
222 atccaaaggtaagagtaataac 243  Q
    ||||||||||||| ||| ||||    
11911450 atccaaaggtaagggtagtaac 11911471  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 18 - 83
Target Start/End: Original strand, 11911153 - 11911218
Alignment:
18 ggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaa 83  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
11911153 ggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagaatcttaattttacattgaa 11911218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 122 - 243
Target Start/End: Original strand, 37960068 - 37960186
Alignment:
122 tgataggatgccgtacgtgaacaatgatatttacctcgagcttgcaaagttagattacaacaattgtcaagcaatgcattatattgaatgggaagaagaa 221  Q
    ||||||||||||||| |||||||||||| |||| || |||||||||| ||| ||||||||||||||||||||||||||||||  |||||||    |||||    
37960068 tgataggatgccgtatgtgaacaatgatgtttatcttgagcttgcaaggttggattacaacaattgtcaagcaatgcattatgatgaatgg---aaagaa 37960164  T
222 atccaaaggtaagagtaataac 243  Q
    || || ||||||||||||||||    
37960165 atacacaggtaagagtaataac 37960186  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 15 - 84
Target Start/End: Original strand, 37959868 - 37959937
Alignment:
15 tatggtggtgaaaatgatgtttggattggcaagaccctttacaggtaagagtcttaattttacattgaat 84  Q
    ||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||    
37959868 tatggtggtgaaaatgatgtttggattggcaagaccctttataggtaagaatcttaattttacattgaat 37959937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University