View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786_high_40 (Length: 246)
Name: NF5786_high_40
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786_high_40 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 10 - 242
Target Start/End: Complemental strand, 32037829 - 32037591
Alignment:
| Q |
10 |
cacctttgtttggtcccgtgagagtcttattacgtacgtattagga-------gcgtccatccatgcacgtgcagccgcgcgtgcggttattgggttgcg |
102 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
32037829 |
cacctttgtttggtcccgcgagagtcttattacgtacgtattaggacttaggagtgtccatccatgcatgtgcagccgcgcgtgcggt-attgggttgcg |
32037731 |
T |
 |
| Q |
103 |
ggtagcgcgaacatggactttttgaccggcctcgcgttatgttatgcttgctcagtaagtcaaatataggagtagcatacaattcttcattcccctcgtt |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32037730 |
ggtagcgcgaacatggactttttgaccggcctcgcgttatgttatgcttgctcagtaagtcaaatataggagtagcatacaattcttcattcccctcgtt |
32037631 |
T |
 |
| Q |
203 |
tatttcattgtannnnnnncatttgttttatattcttgga |
242 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||| |
|
|
| T |
32037630 |
tatttcattgtatttttttcatttgttttattttcttgga |
32037591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University