View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786_high_50 (Length: 238)
Name: NF5786_high_50
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786_high_50 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 5 - 220
Target Start/End: Original strand, 34131646 - 34131861
Alignment:
| Q |
5 |
ggatttggatcctctaccgttgcgtgttgcaattgtagggactgttagatttagagaaagaaattatataattgttttctctctaaatctaatgtcgtcg |
104 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
34131646 |
ggatttggatcctctactgttgcgtgttgcaattgtagggaccgttagatttagagaaagaaattatataattgttttctctctaaatctaacgccgtcg |
34131745 |
T |
 |
| Q |
105 |
caatcacaaatatagagatccaaacatgaccaaataagtaataataaagaatgatccaaagtatttaaggtagactctcacattatcataaaatttagat |
204 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34131746 |
caatcacaaatgtaaagatccaaacatgaccaaataagtaataacaaagaatgatccaaagtatttaaggtagactctcacattatcataaaatttagat |
34131845 |
T |
 |
| Q |
205 |
tgggtctaactcaaat |
220 |
Q |
| |
|
|| ||||||||||||| |
|
|
| T |
34131846 |
tgagtctaactcaaat |
34131861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University