View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786_low_27 (Length: 333)
Name: NF5786_low_27
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 328
Target Start/End: Original strand, 1022853 - 1023170
Alignment:
| Q |
1 |
ttgaggacctttattgatgatgtttcctgcttaaggtgtttagaagtnnnnnnnnnnttaagattttgtgcatgtctgatatcagtgtgagttcgacaaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1022853 |
ttgaggacctttattgatgatgtttcctgcttaaggtgtttagaagtaaaaaaaaa-ttaagattttgtgcatgtctgatatcagtgtgagttcgacaaa |
1022951 |
T |
 |
| Q |
101 |
atcactttgacatcataattttcttgaagttacaaagtgtagcttttgcaaaattatagtgatttgccgtgattttgcttaactcaccgcgatacacggg |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1022952 |
atcactttgacatcataattttgttgaagttacaaagtgtagcttttgcaaaattatagtgatttgccatgattttgcttaactcaccgcgatacacggg |
1023051 |
T |
 |
| Q |
201 |
caagactatatatatgattcaatgctgagtcgtaaggaatgggtcgagtaggccgagtggatggattacgggccaagtatattcacaaggctatagttgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1023052 |
caagactatatatatgattcaatgctgagttgtaaggaatgggt---------cgagtggatggattacgggccaagtatattcacaaggctatagttgc |
1023142 |
T |
 |
| Q |
301 |
gggagcttcttctcttccctatgattct |
328 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
1023143 |
gggagcttcttctcttccctgtgattct |
1023170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 95 - 153
Target Start/End: Complemental strand, 3643781 - 3643723
Alignment:
| Q |
95 |
gacaaaatcactttgacatcataattttcttgaagttacaaagtgtagcttttgcaaaa |
153 |
Q |
| |
|
||||||||||| ||||| ||| ||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
3643781 |
gacaaaatcacagtgacaccatgattttattgaagctacaaagtgtagcttttgcaaaa |
3643723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 92 - 176
Target Start/End: Original strand, 34404141 - 34404225
Alignment:
| Q |
92 |
ttcgacaaaatcactttgacatcataattttcttgaagttacaaagtgtagcttttgcaaaattatagtgatttgccgtgatttt |
176 |
Q |
| |
|
|||||||||||||| ||||| | | |||| |||||| ||| |||||||||||||||||||||| |||| ||||| ||||||| |
|
|
| T |
34404141 |
ttcgacaaaatcacggtgacaccgtgcttttgttgaagctacgaagtgtagcttttgcaaaattacggtgacttgccatgatttt |
34404225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University