View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786_low_31 (Length: 297)
Name: NF5786_low_31
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 2e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 10 - 171
Target Start/End: Complemental strand, 1022875 - 1022714
Alignment:
| Q |
10 |
acatcatcaataaaggtcctcaaaaaataatgaagaagtgtttacagttacattaaacaatgcaccgaaagtgactgattctgtgattcaaagtcaagat |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1022875 |
acatcatcaataaaggtcctcaaaaaataatgaagaagtgtttacagttacattaaacaatgcaccgaaagtgactgattctgtgattcaaagtcaagat |
1022776 |
T |
 |
| Q |
110 |
accatcaattattagtactatatgttcccactacgctacccgtacaagacctttacattgtt |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1022775 |
accatcaattattagtactatatgttcccactacgctacccgtacaagacctttacattgtt |
1022714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 235 - 280
Target Start/End: Complemental strand, 1022667 - 1022622
Alignment:
| Q |
235 |
ttgattgagttaacgacgaaaacgaaaacgaaaactcaccttcact |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1022667 |
ttgattgagttaacgacgaaaacgaaaacgaaaactcaccttcact |
1022622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University