View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF5786_low_34 (Length: 287)
Name: NF5786_low_34
Description: NF5786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF5786_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 5 - 250
Target Start/End: Complemental strand, 4458258 - 4458013
Alignment:
| Q |
5 |
tgtcgaagaatataattgaagaatcggagtatgtaccattgactcatgaagaaagggggagcttgagacattgattgaataggctactactaaacaaaat |
104 |
Q |
| |
|
||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
4458258 |
tgtcgaacactataattgaagaatcggagtatgtaccattgactcatgaagaaagggggagcttgagagattggttgaataggctactactaaacaaaat |
4458159 |
T |
 |
| Q |
105 |
actaagaaacctgaattggaacatcctattagtgttgatattttgaatgttaaggcttcctagcgtctccattgtcgatgttcttaagcaatgagtcaac |
204 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| || |||| |||||||||||||||||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
4458158 |
actaagaaacctgaattgtaacatcctattagtgttgacatattgagtgttaaggcttcctagcgtctccattgtcgctgttcttaagcaaagagtcaac |
4458059 |
T |
 |
| Q |
205 |
cttgtccatcaatcttgctcttcagaccttttcaccagtttcattc |
250 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||| |
|
|
| T |
4458058 |
cttgtccatcaatcttgcttttcggaccttttcaccagtttcattc |
4458013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University